View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_high_17 (Length: 323)
Name: NF1566_high_17
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1566_high_17 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 28820085 - 28819781
Alignment:
Q |
1 |
gagtttattgaaatccttgaggtggcagatgatcttgtgatatgttgatttttgtttttaattcatttttcagaatgaattagtgaccactgttttgtct |
100 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28820085 |
gagtttattgaaatccttgaggtggcaaatgatcttgtgatatgttgatttttgtttttaattcatttttcagaatgaattagtgaccactgttttgtct |
28819986 |
T |
|
Q |
101 |
gtcattttgtcgatatttaacaggtttgccggactttgctgaagtttacggtttcattggaagtgtttttgatccggatacaaacggccatgtgcagaag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28819985 |
gtcattttgtcgatatttaacaggtttgccggactttgctgaagtttacggtttcattggaagtgtttttgatccggatacaaacggccatgtgcagaag |
28819886 |
T |
|
Q |
201 |
ctgaaggaaatggaccctataaattttgaaactgtgagttgattacttgaatgcaatttattatcatatacagaagctactgcaaagatgaaacttagct |
300 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
28819885 |
ctgaaggaaatggaccctataaattttgaaactgtgagttgattacttgaatgcaatttattatcatatacagaaataactgcaaagatgaaacttagct |
28819786 |
T |
|
Q |
301 |
ctatg |
305 |
Q |
|
|
|||| |
|
|
T |
28819785 |
atatg |
28819781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 28820234 - 28820194
Alignment:
Q |
1 |
gagtttattgaaatccttgaggtggcagatgatcttgtgat |
41 |
Q |
|
|
|||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
28820234 |
gagtttattgaaatccttgaggtgccaaatgatcttgtgat |
28820194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 202
Target Start/End: Complemental strand, 11931678 - 11931594
Alignment:
Q |
118 |
taacaggtttgccggactttgctgaagtttacggtttcattggaagtgtttttgatccggatacaaacggccatgtgcagaagct |
202 |
Q |
|
|
|||||||||||| || || | |||| |||| |||||| || ||||||||| ||||| ||| |||||| |||||| ||||||||| |
|
|
T |
11931678 |
taacaggtttgcttgatttggatgaattttaaggtttcgttagaagtgtttatgatcaggacacaaacagccatgcgcagaagct |
11931594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13707 times since January 2019
Visitors: 8302