View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_high_23 (Length: 288)
Name: NF1566_high_23
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1566_high_23 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 8457213 - 8456928
Alignment:
Q |
1 |
ttctgttgcttcaacttttgaagtaaagcttttaattgatgctcagaaccatatttactattaagagagtaaaggttctgaggagtgtaacctgcaaaac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8457213 |
ttctgttgcttcaacttttgaagtaaagcttttaattgatgctcagaaccatatttactattaagagagtaaaggttctgaggagtgtaacctgcaaaac |
8457114 |
T |
|
Q |
101 |
agaggaaagacaataaattattgcactttaagaccctagaatcgtatgcctaatacttcaaaggcagttgattttaccttcaggcgagaaggaatgagtt |
200 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
8457113 |
agaggaaagacaataaattattgcacttcaagaccctagaatcgtatgcctaatacttcaaaggcagttgatttaaccttcaggcgagaaggaatgagtt |
8457014 |
T |
|
Q |
201 |
ggcggtggcaaccatgctgaagtgattccagctttagctatgtccggaactttgctttctaaatttgcccaccaatcgtatctgtg |
286 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
8457013 |
ggcggtggcaaccatgctgaagtgattccagctttagctatgtccggaactttgctttctaaatttgcccaccaatcgtatttgtg |
8456928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13161 times since January 2019
Visitors: 8270