View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_high_34 (Length: 238)
Name: NF1566_high_34
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1566_high_34 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 26954931 - 26954721
Alignment:
Q |
18 |
atttagactacaccaaggtgaacaaatttaatatcaaattatgaaatcacactcgtaaaagcaatgaccaacaataattgaaactccaattccaacagtt |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26954931 |
atttagactacaccaaggtgaacaaatttaatatcaaattatgaaatcacactcttaaaagcaatgaccaacaataattgaaactccaattccaacagtt |
26954832 |
T |
|
Q |
118 |
gattaccgcgcgcactatgaatgaagtcttccctttttctttaaataaccaaatatcaattcatacttactcctcttgtctctattgcaatttgcaatag |
217 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26954831 |
gattaccgcgcgcactatgaatgaagtcttccctttttctttaaataaccaaatatcaattcatacttactcctcttgtctctattgcaatttgcaataa |
26954732 |
T |
|
Q |
218 |
tctttttcttc |
228 |
Q |
|
|
||||||||||| |
|
|
T |
26954731 |
tctttttcttc |
26954721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14827 times since January 2019
Visitors: 8422