View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_high_37 (Length: 234)
Name: NF1566_high_37
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1566_high_37 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 3 - 67
Target Start/End: Complemental strand, 5752520 - 5752456
Alignment:
Q |
3 |
gctgatacctgaattgacagcaagggaaacaactctcctccatgcggtttggcattcaattattt |
67 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
5752520 |
gctgatacctgaattgacagcaagggaaacaactctcctccatgcggtttggcgttcaattattt |
5752456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 143 - 220
Target Start/End: Complemental strand, 5752355 - 5752278
Alignment:
Q |
143 |
tcctttccaaatacgggcaagttcacccaatgccaaatcccatcccttttcagtgctctttgcactgatcagattcat |
220 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||| |||||||||||| |
|
|
T |
5752355 |
tcctttccaaatacgggcaagttcacccaattccaaatcccaacccttttcagcactctttgcacggatcagattcat |
5752278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 83 - 135
Target Start/End: Complemental strand, 5752452 - 5752399
Alignment:
Q |
83 |
ttgcgaactttggatccacaagaaggtttgtaagattaggg-ttctgtcgtacg |
135 |
Q |
|
|
||||||||| |||||||||||||||||| | ||||||||| |||||||||||| |
|
|
T |
5752452 |
ttgcgaactctggatccacaagaaggttagcgagattagggtttctgtcgtacg |
5752399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11380 times since January 2019
Visitors: 8091