View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_26 (Length: 266)
Name: NF1566_low_26
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1566_low_26 |
 | |
|
| [»] scaffold0005 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0005 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 13 - 131
Target Start/End: Original strand, 255844 - 255962
Alignment:
| Q |
13 |
attaatgtgatgaagtttttgcatcgaaaggttttggttagaaaaggaatttgaactcacccacgtacctttcattttgtgtaacaaaaaacagtgtact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
255844 |
attaatgtgatgaagtttttgcatcgaaaggttttgcttagaaaaggaatttgaattcacccagatacctttcattttgtgtaacaaaaaacagtgtact |
255943 |
T |
|
| Q |
113 |
tcaggttataaataacttg |
131 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
255944 |
ttaggttataaataacttg |
255962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 187 - 225
Target Start/End: Original strand, 256008 - 256046
Alignment:
| Q |
187 |
gatattctagattggggagaatatgtttctttctgtttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
256008 |
gatattctagattggggagaatatgtttctttctgtttt |
256046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15778 times since January 2019
Visitors: 3757