View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_28 (Length: 253)
Name: NF1566_low_28
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1566_low_28 |
| |
|
[»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 253
Target Start/End: Original strand, 54909866 - 54910106
Alignment:
Q |
13 |
aatattactaacctatttcaacttgctttgatccagtaacaatataaccttcaactccacggacaatatccctttgataatgctgaaagaaataaataca |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54909866 |
aatattactaacctatttcaacttgctttgatccagtaacaatataaccttcaactccacggacaatatccctttgataatgctgaaagaaataaataca |
54909965 |
T |
|
Q |
113 |
tgtcattatcagtaatgaaggaagggtataggttaaagtgaaacaaaacaaaattagaggattggtacagaggaaccaagtaacctttcctgcacgtgtg |
212 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54909966 |
tgtcattatcggtaatgaaggaagggtataggttaaagtgaaacagaacaaaattagaggattggtacagaggaaccaagtaacctttcctgcacgtgtg |
54910065 |
T |
|
Q |
213 |
gatatgtaaagcttctcaagcttctgatgttgttgaagctc |
253 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54910066 |
gatatgtaaagcttctcaagcttctgatgttgttgaagctc |
54910106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 27043598 - 27043682
Alignment:
Q |
16 |
attactaacctatttcaacttgctttgatccagtaacaatataaccttcaactccacggacaatatccctttgataatgctgaaa |
100 |
Q |
|
|
|||||| |||||||||||||||||| ||||| ||||||||||||||||| |||||||| |||| |||||||||||||||||||| |
|
|
T |
27043598 |
attacttacctatttcaacttgcttggatcctgtaacaatataaccttctactccacgaacaacgtccctttgataatgctgaaa |
27043682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 193 - 242
Target Start/End: Original strand, 27044043 - 27044092
Alignment:
Q |
193 |
taacctttcctgcacgtgtggatatgtaaagcttctcaagcttctgatgt |
242 |
Q |
|
|
||||||| || |||||||| ||||||||||| |||||||| ||||||||| |
|
|
T |
27044043 |
taaccttcccggcacgtgttgatatgtaaagtttctcaagtttctgatgt |
27044092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9239 times since January 2019
Visitors: 7893