View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_30 (Length: 249)
Name: NF1566_low_30
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1566_low_30 |
| |
|
[»] chr1 (1 HSPs) |
| |
|
[»] scaffold0034 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 8 - 249
Target Start/End: Complemental strand, 1326646 - 1326405
Alignment:
Q |
8 |
agatgaacttaggaacaagcttttcaggatattggtttggaccataaacattattgcctctagaggttataattggaagatcataggatctatgataagc |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1326646 |
agatgaacttaggaacaagcttttcaggatattggtttggaccataaacattattgcctctagaggttataattggaagatcataggatctatgataagc |
1326547 |
T |
|
Q |
108 |
cataaccaacatttcagcacctgcttttgttgcagaataaggatttgttggtaaaagctgagatgtttcatggtttccgatattggcatctaaatcggtt |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1326546 |
cataaccaacatttcagcacctgcttttgttgcagaataaggatttgttggtaaaagctgagatgtttcatggtttccgatattggcatctaaatcggtt |
1326447 |
T |
|
Q |
208 |
tcaccataaacttcatcagtactaacatgaatgaacctttta |
249 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1326446 |
tcaccataaacttcatcagtactaacatgaatgaacctttta |
1326405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 246
Target Start/End: Complemental strand, 20272 - 20143
Alignment:
Q |
117 |
catttcagcacctgcttttgttgcagaataaggatttgttggtaaaagctgagatgtttcatggtttccgatattggcatctaaatcggtttcaccataa |
216 |
Q |
|
|
|||||| || ||||||||||||||||| || || ||||| || | ||| ||||| | ||||||||||| | | |||||| |||||| || ||||| |
|
|
T |
20272 |
catttccgctcctgcttttgttgcagagtacgggtttgtgggaagaagttgagaagcctcatggtttccaacaacagcatcttcatcggtctccccatag |
20173 |
T |
|
Q |
217 |
acttcatcagtactaacatgaatgaacctt |
246 |
Q |
|
|
|| ||||| ||||| ||||||||||||||| |
|
|
T |
20172 |
acctcatcggtactgacatgaatgaacctt |
20143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 185
Target Start/End: Complemental strand, 17798300 - 17798252
Alignment:
Q |
137 |
ttgcagaataaggatttgttggtaaaagctgagatgtttcatggtttcc |
185 |
Q |
|
|
||||||||||||| |||||| |||||||||||| | |||||||||||| |
|
|
T |
17798300 |
ttgcagaataagggtttgtttctaaaagctgagaggcttcatggtttcc |
17798252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 185
Target Start/End: Complemental strand, 19106740 - 19106692
Alignment:
Q |
137 |
ttgcagaataaggatttgttggtaaaagctgagatgtttcatggtttcc |
185 |
Q |
|
|
||||||||||||| |||||| |||||||||||| | |||||||||||| |
|
|
T |
19106740 |
ttgcagaataagggtttgtttctaaaagctgagaggcttcatggtttcc |
19106692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11246 times since January 2019
Visitors: 8059