View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_33 (Length: 240)
Name: NF1566_low_33
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1566_low_33 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 1326224 - 1326000
Alignment:
Q |
1 |
cccttgatgaatttgaattttggtgatgaagtgcatgattgtaaattcttgaaagttgagcaataatctagtttatcaagtgctacaatcttgtagctag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1326224 |
cccttgatgaatttgaattttggtgatgaagtgcatgattgtaaattcttgaaagttgagcaataatctagtttatcaagtgctacaatcttgtagctag |
1326125 |
T |
|
Q |
101 |
gatacttgttaattatcctcgtggttacatgtgaagctatgaaaccagcagctccagttatcagaatattctttggttcatacatttcttcggcttttga |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
1326124 |
gatacttgttaattatcctcgtggttacatgtgaagctatgaaaccagcagctccagttatcagaatattctttggttcatacatttctccggcttttga |
1326025 |
T |
|
Q |
201 |
ttatatctttcttcgtagtgtttct |
225 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
1326024 |
ttatatctttcttcgtagtgtttct |
1326000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14126 times since January 2019
Visitors: 8375