View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_34 (Length: 240)
Name: NF1566_low_34
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1566_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 28820426 - 28820650
Alignment:
| Q |
1 |
tgctgatcccctttgatccaatgtcagctgaatcagtaacatcatataacataataagtagtggcaagttcctttaagtttagctagacaatctagacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28820426 |
tgctgatcccctttgatccaatgtcagctgaatcagta-catcatataacataataagtagtggcaagttcctttaagtttagctagacaatctagacta |
28820524 |
T |
|
| Q |
101 |
ttgaccattggaatcaaaattcaaacaatactaaagagaagaatgcataacattatgcataccttcatttccatgaagactgttgagttcatcctgacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28820525 |
ttgaccattggaatcaaaattcaaacaatactaaagagaagaatgcataacattatgcataccttcatttccgtgaagactgttgagttcatcctgacaa |
28820624 |
T |
|
| Q |
201 |
gtattcatcagcatggacgtttcatc |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28820625 |
gtattcatcagcatggacgtttcatc |
28820650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12607 times since January 2019
Visitors: 8222