View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_35 (Length: 238)
Name: NF1566_low_35
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1566_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 38938098 - 38937875
Alignment:
| Q |
1 |
atacatgagtgcaagaatttaacatatcttgacctctctgagaacagttggaatggtaccataccagaattcctttatggtaatttaggaatgcttgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38938098 |
atacatgagtgcaagaatttaacatatcttgacctctctgagaacagttggaatggtaccataccagaattcctttatggtaatttaggaatgcttgaat |
38937999 |
T |
|
| Q |
101 |
atctcaacctcaccaactgtggactaaaaggaacactatcatccaacttgtcctttctctcgaatctcaaagatcttcgcattggtaataacatgtttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38937998 |
atctcaacctcaccaactgtggactagaaggaacactatcatccaacttgtcccttctctcgaatctcaaagatcttcgcattggtaataacatgtttaa |
38937899 |
T |
|
| Q |
201 |
tagtcatattccaacagagatagg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38937898 |
tagtcatattccaacagagatagg |
38937875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9924 times since January 2019
Visitors: 7932