View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_37 (Length: 237)
Name: NF1566_low_37
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1566_low_37 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 55481540 - 55481321
Alignment:
Q |
1 |
tggatcatgatttctcaataagaatcgtttctgtcatctccaaacgattaattaggcctattgtttcttgttattcaagcattttaattatttcatttat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55481540 |
tggatcatgatttctcaataagaatcgtttctgtcatctccaaacgattaattaggcctattgtttcttgttattcaagcattttaattatttcatttat |
55481441 |
T |
|
Q |
101 |
tttttggtatagttattcaagtatttcaaccaggcctcaagtatttgaagtgatacgaaaataccgtttaagttgaagacaacaataaaaccatcaatat |
200 |
Q |
|
|
|||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55481440 |
tttttggtatagttattcaagtattttaatcaggcctcaagtatttgatgtgatacgaaaataccgtttaagttgaagacaacaataaaaccatcaatat |
55481341 |
T |
|
Q |
201 |
tgtatgaaacaaattgttgg |
220 |
Q |
|
|
|||| ||||||||||||||| |
|
|
T |
55481340 |
tgtacgaaacaaattgttgg |
55481321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8551 times since January 2019
Visitors: 7803