View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_38 (Length: 236)
Name: NF1566_low_38
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1566_low_38 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 38938170 - 38938397
Alignment:
Q |
1 |
attgagaccaatcaacggaagatacaaaaaagtttgatccaagatcaaggtaacttaccttggagagattagtgagctgatagggaatggtaccattgag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38938170 |
attgagaccaatcaacggaagatacaaaaaagtttgatccaagatcaaggtaacttaccttggagagattagtgagctgatagggaatggtaccattgag |
38938269 |
T |
|
Q |
101 |
attattgaagtaaaaactaacatattgaagttcttttagatggcctagctcggatggtagcgcgtcttcaaataaattgtttcccaagtctaagaaagtg |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
T |
38938270 |
attattgaagtaaaaactaacatattgaagttcctttagatggcctagctcggatggtagtgcgtcttcaaataaattgtttcccaagtctaagaaattg |
38938369 |
T |
|
Q |
201 |
agcttggagagtttgccaattgatgatg |
228 |
Q |
|
|
||||| |||||| ||||||||||||||| |
|
|
T |
38938370 |
agctttgagagtgtgccaattgatgatg |
38938397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15994 times since January 2019
Visitors: 3757