View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_41 (Length: 225)
Name: NF1566_low_41
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1566_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 12303384 - 12303189
Alignment:
| Q |
16 |
agaagcactcgaaggcgaaataatcttgcaaatacctggaatttatcaaaaattcaaatgnnnnnnngttcagtaacaattctatcattctgctgagttc |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
12303384 |
agaagcactcaaaggcgaaataatcttgcatatacctggaatttatcaaaaattcaaatgaaaaaaagttcggtaacaattctatcattctgctgagttc |
12303285 |
T |
|
| Q |
116 |
atctatcctttccataaagaggacacggtaaattaacatttaactactacaatctccatacctgtcagtaagtctattgagttttcatattatttt |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12303284 |
atctatcctttccataaagaggacatggtaaattaacatttaactactacaatctccatacctgtcagtaagtctattgagttttcatattatttt |
12303189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12124 times since January 2019
Visitors: 8179