View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_42 (Length: 217)
Name: NF1566_low_42
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1566_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 139 - 204
Target Start/End: Complemental strand, 40217148 - 40217080
Alignment:
| Q |
139 |
gtagtgcataccatgagctattatg---ggaagagtatacaaaatggatttcagttgtggagtataaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40217148 |
gtagtgcataccatgagctattattcttggaagagtatccaaaatggatttcagttgtggagtataaaa |
40217080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8411 times since January 2019
Visitors: 7802