View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_low_7 (Length: 434)
Name: NF1566_low_7
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1566_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 5e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 10 - 206
Target Start/End: Complemental strand, 37325041 - 37324850
Alignment:
| Q |
10 |
catatgcaaaatatcatggggtatgtgtggaaaataaataaatttacatggtctgtttttgggttacaatgattattttgcagacaaatgcatgcttnnn |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37325041 |
catatgcaaaatatcatggggtatgtgtggaaaataaat----ttacatggtttgtttttgggttacaatgattattttgcagacaaatgcatgcttaaa |
37324946 |
T |
|
| Q |
110 |
nnnntatttacataatatcattaggctctctgatgaagaatacttcacatcaataacatagttaaaaaatactttgataaaaatgaaatatattacc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37324945 |
aaa-tatttacataatatcattaggctctctgatgaagaatacctcacatcgataacatagttaaaaaatattttgataaaaatgaaatatattacc |
37324850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 348 - 418
Target Start/End: Complemental strand, 37324710 - 37324640
Alignment:
| Q |
348 |
atagtgagaaacatatagatgttggctttagcacaacagagttctacgacaatgtgaatcaagattgaaat |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37324710 |
atagtgagaaacatatagatgttggctttagcacaatagagttctacgacaatgtgaatcaagattgaaat |
37324640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12034 times since January 2019
Visitors: 8179