View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571-INSERTION-2 (Length: 118)
Name: NF1571-INSERTION-2
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571-INSERTION-2 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 47; Significance: 3e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 25296767 - 25296717
Alignment:
Q |
8 |
aggatttctaccgtatgttagtaacagtgaatatcattgagctataaaata |
58 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25296767 |
aggacttctaccgtatgttagtaacagtgaatatcattgagctataaaata |
25296717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9792 times since January 2019
Visitors: 7932