View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_high_4 (Length: 536)
Name: NF1571_high_4
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_high_4 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 7e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 17 - 121
Target Start/End: Complemental strand, 26854996 - 26854889
Alignment:
Q |
17 |
agagaggagatgcaaatcctagaga---ttgtggatatacgtcaaagtgggagatctagtgttcccatttcattctaatggttaaccattttttctttat |
113 |
Q |
|
|
|||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26854996 |
agagaggagatgcaaaccctagagaagattgtggatatacgtcaaactgggagatctagtgttcccatttcattctaatggttaaccattttttctttat |
26854897 |
T |
|
Q |
114 |
ttgtgagg |
121 |
Q |
|
|
|||||||| |
|
|
T |
26854896 |
ttgtgagg |
26854889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 485 - 526
Target Start/End: Complemental strand, 11076065 - 11076024
Alignment:
Q |
485 |
aaattaagttttaagtttatctctcacaatgagatatttcat |
526 |
Q |
|
|
||||||||||||||| |||||||||| ||||||| ||||||| |
|
|
T |
11076065 |
aaattaagttttaagcttatctctcagaatgagagatttcat |
11076024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 473 - 525
Target Start/End: Complemental strand, 8266983 - 8266931
Alignment:
Q |
473 |
gagggagaggcaaaattaagttttaagtttatctctcacaatgagatatttca |
525 |
Q |
|
|
||||||||| |||||||||||| ||| |||||||||| ||||||| |||||| |
|
|
T |
8266983 |
gagggagagccaaaattaagttccaagcttatctctcaaaatgagagatttca |
8266931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14010 times since January 2019
Visitors: 8375