View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_high_55 (Length: 206)
Name: NF1571_high_55
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_high_55 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 29858062 - 29857890
Alignment:
Q |
18 |
agaagcacatttggatggagcttatttgccttagatgaagagagatttagatcatagtcttctcaaggattggagcttggttattctctaaaagtcttga |
117 |
Q |
|
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
T |
29858062 |
agaagcacttttggatggagcttatttcccttagatgaagagagatttagatcatagtcttctcagagattgaagcttggttattctctaaaagtcttga |
29857963 |
T |
|
Q |
118 |
aatttcatctataagaaagtggaaataacatggcatatgtgatttgggcatggcctgcaatctactgtttcat |
190 |
Q |
|
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29857962 |
aatttcatccataagaaagtggaaatagcatggcatatgtgatttgggcatggcctgcaatctactgtttcat |
29857890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12675 times since January 2019
Visitors: 8222