View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_high_7 (Length: 493)
Name: NF1571_high_7
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_high_7 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 23 - 478
Target Start/End: Complemental strand, 4760584 - 4760138
Alignment:
Q |
23 |
caagttcatacttatttatttatttttattacttttgtgacttgaagatcaactcaagcccatatgaagatggatggatgatcaaaataaagccaagtga |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4760584 |
caagttcatacttatttatttatttttattacttttgtgacttgaagatcaactcaagcccatatgaagatggatggatgatcaaaataaagccaagtga |
4760485 |
T |
|
Q |
123 |
tccatctgaattagaatccttgttgggtgcaaaggagtacacaaaattttgtgaggaagaagatgctgcacattgaaattaattt-caatatatgggact |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
4760484 |
tccatctgaattagaatccttgttgggtgcaaaggagtacacaaaattttgtgaggaagaagatgctgcacattgaaattaattttcaatatatgggact |
4760385 |
T |
|
Q |
222 |
gactcnnnnnnnatatatgtactatgatattgttatctactttcttcaagtgcaatagaattgcttcaagttgttattgttttttccttgctattattgt |
321 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
T |
4760384 |
gactctttttttatatatgtactatgatattgttatctactttcttcaagtgcaatagaattgcttcaagttgttattgttctttccttgctactattgt |
4760285 |
T |
|
Q |
322 |
cattgttaccgacacttcagtgtgtcagtctttctatctagtcatgtaattaagaaggaaatttctctctttcacctctatccattattattttcatttc |
421 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
4760284 |
cattgttaccgacacttcagtgtgtcagtctttctatctagtcatgtaattaagaaggaaatttctta--ttcacctctatccattattattttcattt- |
4760188 |
T |
|
Q |
422 |
atttgaatgcttcttcgtagataaaaacacatgtttgatagcgaagttcggtcaatt |
478 |
Q |
|
|
||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
4760187 |
----gaatgcttc---gtagttaaaaacacatgtttgatagcgaagttcggtcaatt |
4760138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11344 times since January 2019
Visitors: 8091