View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_12 (Length: 454)
Name: NF1571_low_12
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_low_12 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 3e-46; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 8154025 - 8153927
Alignment:
Q |
1 |
tacagttacaagctgtagcatttgtgtcttttgaatacttccatttgaaataactttatttttattagattgccctgccgtttcgagaatcttggaata |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
8154025 |
tacagttacaagctgtagcatttgtgtcttttgaatacttccatttgaaataactttatttttaatagattgccctgccgtttcgagaatcttggaata |
8153927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 380 - 437
Target Start/End: Complemental strand, 8152906 - 8152849
Alignment:
Q |
380 |
aattggacgcctcagatttttcacttattaaggcattcactttttgttgggtattgct |
437 |
Q |
|
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
8152906 |
aattggacggctcagatttttgacttattaaggcattcactttttgttgggtattgct |
8152849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 289 - 347
Target Start/End: Complemental strand, 8153764 - 8153706
Alignment:
Q |
289 |
gcttgagtctatggtagggtttaatatgagaaagttgagttctttcttatcataggaaa |
347 |
Q |
|
|
||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
8153764 |
gcttgagtctatggtgggatttagtatgagaaagttgagttctttcttatcataggaaa |
8153706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 371
Target Start/End: Complemental strand, 4833929 - 4833865
Alignment:
Q |
307 |
gtttaatatgagaaagttgagttctttcttatcataggaaagtttaaccaataccatagatataa |
371 |
Q |
|
|
|||||||||| ||||| ||||||||||||| || |||||||| ||||| ||||||||||||| |
|
|
T |
4833929 |
gtttaatatgggaaagaaaagttctttcttatgatgggaaagttcaaccacaaccatagatataa |
4833865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11006 times since January 2019
Visitors: 8059