View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1571_low_12 (Length: 454)

Name: NF1571_low_12
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1571_low_12
NF1571_low_12
[»] chr7 (3 HSPs)
chr7 (1-99)||(8153927-8154025)
chr7 (380-437)||(8152849-8152906)
chr7 (289-347)||(8153706-8153764)
[»] chr6 (1 HSPs)
chr6 (307-371)||(4833865-4833929)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 3e-46; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 8154025 - 8153927
Alignment:
1 tacagttacaagctgtagcatttgtgtcttttgaatacttccatttgaaataactttatttttattagattgccctgccgtttcgagaatcttggaata 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
8154025 tacagttacaagctgtagcatttgtgtcttttgaatacttccatttgaaataactttatttttaatagattgccctgccgtttcgagaatcttggaata 8153927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 380 - 437
Target Start/End: Complemental strand, 8152906 - 8152849
Alignment:
380 aattggacgcctcagatttttcacttattaaggcattcactttttgttgggtattgct 437  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||    
8152906 aattggacggctcagatttttgacttattaaggcattcactttttgttgggtattgct 8152849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 289 - 347
Target Start/End: Complemental strand, 8153764 - 8153706
Alignment:
289 gcttgagtctatggtagggtttaatatgagaaagttgagttctttcttatcataggaaa 347  Q
    ||||||||||||||| || |||| |||||||||||||||||||||||||||||||||||    
8153764 gcttgagtctatggtgggatttagtatgagaaagttgagttctttcttatcataggaaa 8153706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 371
Target Start/End: Complemental strand, 4833929 - 4833865
Alignment:
307 gtttaatatgagaaagttgagttctttcttatcataggaaagtttaaccaataccatagatataa 371  Q
    |||||||||| |||||   ||||||||||||| || |||||||| |||||  |||||||||||||    
4833929 gtttaatatgggaaagaaaagttctttcttatgatgggaaagttcaaccacaaccatagatataa 4833865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 11006 times since January 2019
Visitors: 8059