View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_26 (Length: 317)
Name: NF1571_low_26
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1571_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 7e-80; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 112 - 297
Target Start/End: Original strand, 49552614 - 49552793
Alignment:
| Q |
112 |
aagataaataaaatagacaccatccgtgccttaattatactgtaagtgtaacatctgctaccagattaccgaaatgcagttatgacaaatgtgtaggcca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49552614 |
aagataaataaaatagacaccatccgtgccttaattatactgta------acatctgctactagattaccgaaatgcagtcatgacaaatgtgtaggcca |
49552707 |
T |
|
| Q |
212 |
tgggtacatcgttacctctacatgaaatatatgttggttcagcaggttcagtattcgtttaatatattttttctatttgttgtctt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49552708 |
tgggtacatcgttacctctacatgaaatatatgttggttcagcaggttcaatattcgtttaatatattttttctatttgttgtctt |
49552793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 40 - 114
Target Start/End: Original strand, 49552511 - 49552585
Alignment:
| Q |
40 |
tgttttacaccttgacggcaaatttagtttgcttctgtagtgtgatttggatcatgttcatgtttctaatctaag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49552511 |
tgttttacaccttgacggcaaatttagtttgcttctgtagtgtgatttggatcatgttcatgtttctaatctaag |
49552585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 158 - 261
Target Start/End: Original strand, 49537360 - 49537465
Alignment:
| Q |
158 |
tgtaacatctgctaccagattaccgaaa-tgcagttatgacaaatgtgtaggcc-atgggtacatcgttacctctacatgaaatatatgttggttcagca |
255 |
Q |
| |
|
|||||| ||||||| ||||||| |||| ||||||||||| |||||| ||| | | ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
49537360 |
tgtaacttctgctagtagattactgaaactgcagttatgagaaatgtatagccagaagggtacatcaatacctctaaatgaaatatatgttggttcagca |
49537459 |
T |
|
| Q |
256 |
ggttca |
261 |
Q |
| |
|
| |||| |
|
|
| T |
49537460 |
gattca |
49537465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8380 times since January 2019
Visitors: 7802