View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1571_low_28 (Length: 309)

Name: NF1571_low_28
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1571_low_28
NF1571_low_28
[»] chr7 (2 HSPs)
chr7 (100-286)||(45367699-45367886)
chr7 (12-56)||(45367930-45367974)


Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 100 - 286
Target Start/End: Complemental strand, 45367886 - 45367699
Alignment:
100 tattggttaattagataaaaatgttaaggtagaaagaagagtgatattgatattgattgggtgggtcaattgatcatagagagtaaccacacaccaccac 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45367886 tattggttaattagataaaaatgttaaggtagaaagaagagtgatattgatattgattgggtgggtcaattgatcatagagagtaaccacacaccaccac 45367787  T
200 ccaaatcattgatagagactgttgttgccaacaaaaatataaacaccagtaggacc-cccctcccttaataactctgcttctctttct 286  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
45367786 ccaaatcattgatagagactgttgttgccaacaaaaatataaacaccagtaggaccccccctcccttaataactctgcttctctttct 45367699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 12 - 56
Target Start/End: Complemental strand, 45367974 - 45367930
Alignment:
12 atgaatgagatccgttttcaccttttgaattgtgttcctagcaat 56  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
45367974 atgaatgagatccgttttcaccttttgaattgtgttcctagcaat 45367930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 14694 times since January 2019
Visitors: 8422