View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_29 (Length: 307)
Name: NF1571_low_29
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_low_29 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 298
Target Start/End: Original strand, 4760698 - 4760995
Alignment:
Q |
1 |
ataaaaatacaccactagttcacttatctctttagctttgcaaagtttcttattctctatttgattgtaaattaaaataacttattcataagctcttata |
100 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4760698 |
ataaacatacaccactagttcacttatctctttagctttgcaaagtttcttattctctatttgattgtaaattaaaataacttattcataagctcttata |
4760797 |
T |
|
Q |
101 |
ttcaataagtacttaagtcattcctaagtaattaaccttcttgtcctaaaaatgagagtgagtgagtgaatgaatgaattaccaggccaggttttccagt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4760798 |
ttcaataagtacttaagtcattcctaagtaattaaccttcttgtcctaaaaatgagagtgagtgagtgaatgaatgaattaccaggccaggttttccagt |
4760897 |
T |
|
Q |
201 |
gagcttatcattaacttcaacaatctcaccagatattggagagtttacatcacttgttgccttaacactttcaacagctccgaaaccgttaccctttg |
298 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
4760898 |
gagcttatcattaacttcaacaatctcaccagatattggagagtttacatcacttgttgccttaacactttcaacagctccgaaaccattaccctttg |
4760995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13211 times since January 2019
Visitors: 8270