View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_34 (Length: 292)
Name: NF1571_low_34
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_low_34 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 42 - 275
Target Start/End: Complemental strand, 10595400 - 10595167
Alignment:
Q |
42 |
caacattggtatatatctaatgcatatacatgaattgcagttaaatatcgttgctgctcaatgaccaaacacaaataaattatattaactaagacagatt |
141 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10595400 |
caacattggtatatatctaatgcatatacgtgaattgcagttaaatatcgttgctgctcaatgaccaaacacaaataaattatattaactaagacagatt |
10595301 |
T |
|
Q |
142 |
ttgacgaatttttgcacggattctctttactggttagtaataacagaaaaaccaagaaagatagaaaagagaaacaatcaacattaaaacaataaattct |
241 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10595300 |
ttgacgaatttttgcacggattctctttattggttagcaataacagaaaaaccaagaaagatagaaaagagaaacaatcaacattaaaacaataaattct |
10595201 |
T |
|
Q |
242 |
tcttggtcctatagatccaaatatcctatcatct |
275 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| |
|
|
T |
10595200 |
tcttggtcctatagatcctaatatcctatcatct |
10595167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14279 times since January 2019
Visitors: 8377