View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_35 (Length: 284)
Name: NF1571_low_35
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1571_low_35 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 14 - 284
Target Start/End: Complemental strand, 19402520 - 19402250
Alignment:
| Q |
14 |
cagagatatattgtgcgccttttgattagtagtggataacaatacagattttgagagttgtcaatgaatgcacttgttatgttatccaaaaaagcagacg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19402520 |
cagagatatattgtgcgccttttgattagtagtggataacaatacagattttgagagttgtcaatgaatgcacttgttatgttatccaaaaaagcagacg |
19402421 |
T |
|
| Q |
114 |
tagatccttctagtcaggctacgatgaagagtgtcaacatttttgtagaccacggaatgtgtcattttagatcgcaaaattttagctattatttaataaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19402420 |
tagatccttctagtcaggctacgatgaagagtgtcaacatttttgtagaccacggaatgtgtcattttagatcgcaaaattttagctattatttaataaa |
19402321 |
T |
|
| Q |
214 |
atagaagtgattaaatgtaaccataagtgtctctattgtgtcgatattggacattgtacatgtcttcaatc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19402320 |
atagaagtgattaaatgtaaccataagtgtctctattgtgtcgatattggacattgtacatgtcttcaatc |
19402250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 52 - 93
Target Start/End: Complemental strand, 19458207 - 19458166
Alignment:
| Q |
52 |
acaatacagattttgagagttgtcaatgaatgcacttgttat |
93 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19458207 |
acaatacagattttgagagttgtcaaggaatgcacttgttat |
19458166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 236 - 284
Target Start/End: Complemental strand, 18018421 - 18018373
Alignment:
| Q |
236 |
ataagtgtctctattgtgtcgatattggacattgtacatgtcttcaatc |
284 |
Q |
| |
|
|||||| | ||| ||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
18018421 |
ataagtctgtctgttgtgccgatattggacattgtacacgtcttcaatc |
18018373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9017 times since January 2019
Visitors: 7893