View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_37 (Length: 278)
Name: NF1571_low_37
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1571_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 53603204 - 53602960
Alignment:
| Q |
1 |
atgtaattaaaaaaccagttattaatcacacaaatatatttagttacataattaatcaaaatttatttcatagcaacaaggtagatggcactgtaatggt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53603204 |
atgtaattgaaaaaccagttattaatcatacaaatatatttagttacataattaatcaaaatttatttcatagcaacaaggtagatggcactgtaat--- |
53603108 |
T |
|
| Q |
101 |
ctttgtaataatattaagttttttaatagaaataaaaatttggttatatatctcatttgacagaaaagtaaatattgttgcttcaatacttattccaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53603107 |
---------aatattaagttttttaatagaaataaaaatttggttatatatctcatttgatagaaaagtaaatattgttgcttcaatacttattccaatt |
53603017 |
T |
|
| Q |
201 |
tacagtgcaaaacaagcaaataaactaattagtcctagataataaatttaatagtgtaag |
260 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53603016 |
tacagtgcaaaacaagcaaataaac---ttagtcctagataataaatttaatagtgtaag |
53602960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10442 times since January 2019
Visitors: 7978