View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_38 (Length: 259)
Name: NF1571_low_38
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_low_38 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 5 - 242
Target Start/End: Original strand, 44956621 - 44956858
Alignment:
Q |
5 |
aaacaacgagtcttggagagaaacaaagaatgtgttatatattgagcaagcattgtaagctcacatctccaagaagggaggtggatagaagtgaaatgag |
104 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
44956621 |
aaacaacgagtcttggagagaaacaaagaatgtgttatatattgagcaagcattgtaagctcacatctccaagaaaggaggtggatagaagtgaaatgag |
44956720 |
T |
|
Q |
105 |
gatacacgtttaagaaaggagacaatcaacatatgcaagacaattcaagagatggcatgatcttgttcaatcttcatcgataacaagaagggaaataagc |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44956721 |
gatacacgtttaagaaaggagacaatcaacatatgcaagacaattcaagagatggcatgatcttgttcaatcttcatcgataacaagaagggaaataagc |
44956820 |
T |
|
Q |
205 |
cacaaaagagacaaaaatttagtattattattagaaca |
242 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||| |
|
|
T |
44956821 |
cacaaaagagacaaaaatttagtattattgttagaaca |
44956858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7755 times since January 2019
Visitors: 7737