View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_51 (Length: 238)
Name: NF1571_low_51
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_low_51 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 19 - 132
Target Start/End: Complemental strand, 36716535 - 36716422
Alignment:
Q |
19 |
gaacgttagaattattaaagataaaccgtttctcaaattcaattcaaatcaaattctagtcaaattatctcaaaagaacgtttatgatcaaagttaacca |
118 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
36716535 |
gaacgttagatttattaaagataaaccgtttctcaaattcaattcaaatcaaattctagtcaaattatctcaaaagaacgtttatgatcaaagctaacca |
36716436 |
T |
|
Q |
119 |
gaatattagctaag |
132 |
Q |
|
|
|||||||||||||| |
|
|
T |
36716435 |
gaatattagctaag |
36716422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 36716375 - 36716333
Alignment:
Q |
179 |
gcatcgcattacaaatgaacaaaacaaccgaataaggataaac |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36716375 |
gcatcgcattacaaatgaacaaaacaaccgaataaggataaac |
36716333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9338 times since January 2019
Visitors: 7893