View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1571_low_51 (Length: 238)

Name: NF1571_low_51
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1571_low_51
NF1571_low_51
[»] chr7 (2 HSPs)
chr7 (19-132)||(36716422-36716535)
chr7 (179-221)||(36716333-36716375)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 19 - 132
Target Start/End: Complemental strand, 36716535 - 36716422
Alignment:
19 gaacgttagaattattaaagataaaccgtttctcaaattcaattcaaatcaaattctagtcaaattatctcaaaagaacgtttatgatcaaagttaacca 118  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
36716535 gaacgttagatttattaaagataaaccgtttctcaaattcaattcaaatcaaattctagtcaaattatctcaaaagaacgtttatgatcaaagctaacca 36716436  T
119 gaatattagctaag 132  Q
    ||||||||||||||    
36716435 gaatattagctaag 36716422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 36716375 - 36716333
Alignment:
179 gcatcgcattacaaatgaacaaaacaaccgaataaggataaac 221  Q
    |||||||||||||||||||||||||||||||||||||||||||    
36716375 gcatcgcattacaaatgaacaaaacaaccgaataaggataaac 36716333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 9338 times since January 2019
Visitors: 7893