View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_54 (Length: 236)
Name: NF1571_low_54
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_low_54 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 219
Target Start/End: Original strand, 40353579 - 40353778
Alignment:
Q |
20 |
ggataatagatcatatttatgttactcaaattacccataactgtgtccaaaaacagcagtgacaaatttacctttttgatctttagagtgttgtaaatac |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
40353579 |
ggataatagatcatatttatgttactcaaattacacataactgtgtccaaaaacagcagtgacaaatttacctttttgttctttagagtgttgtaaatac |
40353678 |
T |
|
Q |
120 |
aaaagttgtgtaggtttgagactcggtattcatcttggtcacattgtatgaatatcttctagataaagtaataaagaagaccatgatttgctttcatctg |
219 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40353679 |
aaaagttgtgtaggtttgagactcggcattcatcttggtcacattgtatgaatatcttcttgataaagtaataaagaagaccatgatttgctttcatctg |
40353778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12434 times since January 2019
Visitors: 8218