View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1571_low_55 (Length: 235)
Name: NF1571_low_55
Description: NF1571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1571_low_55 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 41820858 - 41821079
Alignment:
Q |
1 |
aattgacatacatatagagatgtcttcatttcattctcaaagaattctttataaagagatagaattacaagaaataggaattcaacatgacaacagtaat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41820858 |
aattgacatacatatagagatgtcttcatttcattctcaaagaattctttataaagagatagaattacaagaaataggaattcaacatgacaacagtaat |
41820957 |
T |
|
Q |
101 |
ttttaccttcttttccatatcttaattgtggtcaatgtacttaataacttattgccaaagatgtttaaaagtgtttctcaaccctaatatttcctatgct |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41820958 |
ttttaccttcttttccatatcttaattgtggtcaacgtacttaataacttattgccaaagatgtttaaaagtgtttctcaaccctaatatttcctatgct |
41821057 |
T |
|
Q |
201 |
ctcagtttttaaccttacaagt |
222 |
Q |
|
|
||| |||||||||||||||||| |
|
|
T |
41821058 |
ctccgtttttaaccttacaagt |
41821079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7913 times since January 2019
Visitors: 7737