View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576-INSERTION-1 (Length: 160)
Name: NF1576-INSERTION-1
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1576-INSERTION-1 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 8 - 159
Target Start/End: Original strand, 44218047 - 44218203
Alignment:
Q |
8 |
agagtacaacccattcccctattccaatattagcatat-----accggttccttccttcatccaataagttgatcaagaacgtgaatactttaatttcgc |
102 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44218047 |
agagtacaacccattcccctattccaatattagcatatcatgcaccggttccttccttcatccaataagttgatcaagaacgtgaatactttaatttcgc |
44218146 |
T |
|
Q |
103 |
ataaaaacaccatgctgcatatgtattggtttttaattagttttaacagttttagta |
159 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
44218147 |
ataaaaacaccatgctgcatatgtattggtttttaatttgttttaacagttttagta |
44218203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16890 times since January 2019
Visitors: 3777