View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576-INSERTION-7 (Length: 273)
Name: NF1576-INSERTION-7
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1576-INSERTION-7 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 20 - 238
Target Start/End: Complemental strand, 10551780 - 10551561
Alignment:
Q |
20 |
agacactaattaggtgacaaaccccaaacactactatataaga-aagtccacaaaaaataagttcggaagctaaggcgacctgatacactttcaacaatc |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |||||| ||||| |||||||| ||| |
|
|
T |
10551780 |
agacactaattaggtgacaaaccccaaacactactatataagggaagtccacaaaaaataagatcggaagctagggcgacgtgataggctttcaaccatc |
10551681 |
T |
|
Q |
119 |
gaaaagacaacaacttcactttattaagttgctcaattaccctagatccttattcttgaaaatgctgtaatttctttctcttcacacaatccaatgacaa |
218 |
Q |
|
|
|||||||||| ||||||||||||| |||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
10551680 |
gaaaagacaataacttcactttataaagtagctcaattatcctagatccttattcttgaaaatgcggtaatttctttctcttcacacaatccaatgacaa |
10551581 |
T |
|
Q |
219 |
gataaccccattaaatctaa |
238 |
Q |
|
|
||||| || ||||||||||| |
|
|
T |
10551580 |
gataatcctattaaatctaa |
10551561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19405 times since January 2019
Visitors: 3809