View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1576-INSERTION-7 (Length: 273)

Name: NF1576-INSERTION-7
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1576-INSERTION-7
NF1576-INSERTION-7
[»] chr2 (1 HSPs)
chr2 (20-238)||(10551561-10551780)


Alignment Details
Target: chr2 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 20 - 238
Target Start/End: Complemental strand, 10551780 - 10551561
Alignment:
20 agacactaattaggtgacaaaccccaaacactactatataaga-aagtccacaaaaaataagttcggaagctaaggcgacctgatacactttcaacaatc 118  Q
    ||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| |||||||||| |||||| |||||  |||||||| |||    
10551780 agacactaattaggtgacaaaccccaaacactactatataagggaagtccacaaaaaataagatcggaagctagggcgacgtgataggctttcaaccatc 10551681  T
119 gaaaagacaacaacttcactttattaagttgctcaattaccctagatccttattcttgaaaatgctgtaatttctttctcttcacacaatccaatgacaa 218  Q
    |||||||||| ||||||||||||| |||| ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
10551680 gaaaagacaataacttcactttataaagtagctcaattatcctagatccttattcttgaaaatgcggtaatttctttctcttcacacaatccaatgacaa 10551581  T
219 gataaccccattaaatctaa 238  Q
    ||||| || |||||||||||    
10551580 gataatcctattaaatctaa 10551561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 19405 times since January 2019
Visitors: 3809