View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_high_39 (Length: 288)
Name: NF1576_high_39
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1576_high_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 105 - 165
Target Start/End: Complemental strand, 12282820 - 12282760
Alignment:
| Q |
105 |
ggatcatgggatcttgaccaaatggtttagctctcggttaaatcaagtccaaaaatttgtt |
165 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12282820 |
ggatcgtgcgatcttgaccaaatggtttagctctcggtaaaatcaagtccaaaaatttgtt |
12282760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 282
Target Start/End: Complemental strand, 12282524 - 12282482
Alignment:
| Q |
240 |
catctttatgttcctctctcttgctcgcctccattcatctcac |
282 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
12282524 |
catctttatgttcctctctcttggtcgcctccattcttctcac |
12282482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18430 times since January 2019
Visitors: 3801