View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1576_high_41 (Length: 282)

Name: NF1576_high_41
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1576_high_41
NF1576_high_41
[»] chr5 (2 HSPs)
chr5 (142-269)||(19596724-19596852)
chr5 (1-45)||(19596623-19596667)


Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 142 - 269
Target Start/End: Original strand, 19596724 - 19596852
Alignment:
142 tgaagaaatgaacatttc-catgatcatatctcctgaaaatgtaactaatatgtaaatttgaacatctttattcactcctcaatcttcttcattcattcc 240  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||    
19596724 tgaagaaatgaacattttgcatgatcatatctcctgaaaatgtaactaatatgtaaatttgaatatctttattcactccttaatcttcttcattcattcc 19596823  T
241 tcaatcttctttgaattgtctgatgatgt 269  Q
    |||||||||||||||||||||||| ||||    
19596824 tcaatcttctttgaattgtctgataatgt 19596852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 19596623 - 19596667
Alignment:
1 attactgatcaaccatttatttattcatgaacaaatacagtacaa 45  Q
    ||||||||||||||||||||||||||||||||||||||| |||||    
19596623 attactgatcaaccatttatttattcatgaacaaatacaatacaa 19596667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 16690 times since January 2019
Visitors: 3774