View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_high_42 (Length: 282)
Name: NF1576_high_42
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1576_high_42 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 125 - 271
Target Start/End: Complemental strand, 34041280 - 34041134
Alignment:
Q |
125 |
tgcagaataacgatgtctctttaaaagtattattatggggtgaattctacttcattttttagtggattaacttgatgaatctataattggatggagggtt |
224 |
Q |
|
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
T |
34041280 |
tgcagaataacgatgtctgtttaaa-gtattattatggggtgaattctacttcattttttagtggatgaacttgatgaatttataattggatggagggtt |
34041182 |
T |
|
Q |
225 |
gg-taattggatcaaattgttatctctatttcaatcaatagggtctgt |
271 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34041181 |
ggttaattggatcaaattgttatctctatttcaatcaatagggtctgt |
34041134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 6 - 117
Target Start/End: Complemental strand, 34042116 - 34042005
Alignment:
Q |
6 |
acatcatggattgcaatatactaataataggtcacagtcacagcttttgccatttaaaatcagtcaacagacataatagacctcaaaaatcttgactatc |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34042116 |
acatcatggattgcaatatactaataataggtcacagtcacagcttttgccatttaaaatcagtcaacagacataatagacctcaaaaatcttgactatc |
34042017 |
T |
|
Q |
106 |
aattgtagtttt |
117 |
Q |
|
|
|||||||||||| |
|
|
T |
34042016 |
aattgtagtttt |
34042005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18864 times since January 2019
Visitors: 3804