View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_high_54 (Length: 239)
Name: NF1576_high_54
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1576_high_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 36203676 - 36203457
Alignment:
| Q |
1 |
tttcaataagttcagcaacttaatgaataaacttggttaaagtattcaaacaaaggataattagaaagtacgtgcgttggatatagaaagttgatatata |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36203676 |
tttcaataagttcagctacttaatgaataaacttggttaaagtattcaaacaaaggataattagaaagtacgtgcgttggatatagaaagttgatttata |
36203577 |
T |
|
| Q |
101 |
attattattatcaacctaaacataatgcatgtttaattatgtgaatcattcaaatactcgtaatgttaaattcatattctcccggcttcaaatattgata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36203576 |
attattattatcaacctaaacataatgcatgtttaattatgtgaatcattcaaatactcataatgttaaattcatattctttcggcttcaaatattgacg |
36203477 |
T |
|
| Q |
201 |
tttctcttttattttcccac |
220 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
36203476 |
tttctcttttatttttccac |
36203457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18850 times since January 2019
Visitors: 3804