View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_high_60 (Length: 227)
Name: NF1576_high_60
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1576_high_60 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 212
Target Start/End: Complemental strand, 34811060 - 34810868
Alignment:
Q |
19 |
tctaagtttattgatgtgattttgaatctcaaattcataatagtaagttggtttgtcatttgaatggcattgcattaggtagtttagtttttaaaattac |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
34811060 |
tctaagtttattgatgtgattttgaatctcaaattcatgatagtaagttggtttgtcatttgaatggcattgcatcaggtagtttagtttttaaaattat |
34810961 |
T |
|
Q |
119 |
taatgagtttcttaaaaatagatgtatatgtactcataagttcataactattgtttaggcaccaaaaattgacattatttaccagagattttca |
212 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||| |||||||| |||||| |||||||||| |
|
|
T |
34810960 |
taatgagtttcttaaaaagagatgtatatgtactcataagttcataactattgtttgggcattaaaagttgacattgtttacc-gagattttca |
34810868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19408 times since January 2019
Visitors: 3809