View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_low_28 (Length: 344)
Name: NF1576_low_28
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1576_low_28 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 19 - 332
Target Start/End: Complemental strand, 4542758 - 4542445
Alignment:
Q |
19 |
actgtacttgatcagttcactgggttgctagaactaggtaaggaacttaggaaagactttatgggggtatgtgtaaacatgtaggtttactatgtcctag |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4542758 |
actgtacttgatcagttcactgggttgctagaactaggtaaggaacttaggaaagactttatgggggtatgtgtaaacatgtaggtttactatgtcctag |
4542659 |
T |
|
Q |
119 |
gtttaggttcctaagagactttagtcgatgatttaaatttctcatggcaatgcaatttctgaattttactgagaatataaacaggcttttgggttgtttg |
218 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
4542658 |
gtttaggttcctaagagactttagtcgatgagttaaatttctcatggcaatgcaatttctgaattttactgagaatataaacatgcttttgggttgtttg |
4542559 |
T |
|
Q |
219 |
ttatcaagttcagcatagaaacatgttggcatgcaacctaattataatctatatgtagctggttagtagttgcaaattcagatttggtctgcgtaattct |
318 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4542558 |
ttatcaagttcagcatagaaacatgttggcatgcaacctaattataatctatatgtagctggttagtagttgcaaattcagatttggtctgcgtaattct |
4542459 |
T |
|
Q |
319 |
tatgcagttatatt |
332 |
Q |
|
|
|||||||||||||| |
|
|
T |
4542458 |
tatgcagttatatt |
4542445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18400 times since January 2019
Visitors: 3801