View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_low_33 (Length: 338)
Name: NF1576_low_33
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1576_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 324
Target Start/End: Complemental strand, 2057123 - 2056799
Alignment:
| Q |
1 |
ttgaatcccaatttgaagattatggaactgaatttttgaaatcagtgtctcgaggcttgtctaaatccataaagtgacttattcaacttgtaaacttggt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2057123 |
ttgaatcccaatttgaagattgtggaactgaatttttgaaagcagtgtctcgaggcttgtctaagtccataaagtgacttattcaacttgtaaacttgga |
2057024 |
T |
|
| Q |
101 |
gcgaagtgaggtagagtcatataccaattcctcactgagttcactgagaaggcaatgagaggagaatccaaacagatgtt-aactttgccacaaatgaaa |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2057023 |
gtgaagtgaggtagagtcatataccaattcctcactgagttcactgagaaggcaatgagaggagaatccaaacagatgttaaactttgccacaaatgaaa |
2056924 |
T |
|
| Q |
200 |
aagtgtctagaaaatctataccatactgttgttgagataacccttgagcgacaagtctctccttgcatatacccatttgcaacctacaacgcgttttcta |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2056923 |
aagtgtctagaaaatctataccatactgttgttgagataacccttgagcgacaagtctctccttgcatatacccatttgcaacctacaacgcgttttcta |
2056824 |
T |
|
| Q |
300 |
gggggaatatgcatgaagatcaagt |
324 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2056823 |
gggggaatatgcatgaagatcaagt |
2056799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 277 times since January 2019
Visitors: 3988