View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_low_34 (Length: 337)
Name: NF1576_low_34
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1576_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 8 - 321
Target Start/End: Original strand, 32259052 - 32259364
Alignment:
| Q |
8 |
aatatagtctaattcaaaatccagacaaactctacaaaatccatcacactgatgtgcctctttcctattacactggaattcttggtacttgagttcttct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
32259052 |
aatatagtctaattcaaaatccagacaaactctacaaaatccatcacactgatgtgcctctttcctattacactggaattcttagtaattgagttcttct |
32259151 |
T |
|
| Q |
108 |
caaannnnnnnattatgctttttctgaatgtaatgctgaaaagaaatgataaatctattatgagagtcagtttttggtagcttctgatgtattttattct |
207 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32259152 |
caa-gttttttattatgctttttctgaatgtaatgctgaaaagaaatgataaatctattatgagagtcagtttttggtagtttctgatgtattttattct |
32259250 |
T |
|
| Q |
208 |
ttctaatccaataggcatgcctggtattactgcatatgccggaatctttgaagttggttctctaaagaaaggagaaagcgtcttcatctcggcggcatca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32259251 |
ttctaatccaataggcatgcctggtattactgcatatgccggaatctttgaagttggttctctaaagaaaggagaaagtgtcttcatctcggcggcatca |
32259350 |
T |
|
| Q |
308 |
ggtgctgtcggtca |
321 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32259351 |
ggtgctgtcggtca |
32259364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16706 times since January 2019
Visitors: 3774