View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_low_35 (Length: 333)
Name: NF1576_low_35
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1576_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 16 - 318
Target Start/End: Original strand, 4410909 - 4411211
Alignment:
| Q |
16 |
ttgatgagataaactattccggttctggtgttagaggccgaggaaataaatcaacttcgttgaacacagccaagcgaaggataggaataaatcgcgacga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4410909 |
ttgatgagataaactattccggttctggtgttagaggccgaggaaataaatcaacttcgtcaaacacaaccaagcgaaggataggaataaatcgcgacga |
4411008 |
T |
|
| Q |
116 |
gagtcctatgtcagaagcttatgctgattcttcattgcaaaggcatgctgttgaatcaaagcaatctcaactcttgatgcttctacagatggtacattgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411009 |
gagtcctatgtcagaagcttatgctgattcttcattgcaaaggcatgctgttgaatcaaagcaatctcaactcttgatgcttctacagatggtacattgc |
4411108 |
T |
|
| Q |
216 |
taaccacttagattacattacattcatttggttttcgtaaaaccgtttacggtcctgattgcgttagtatatgtctgctggtttcactcttgaacatgga |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411109 |
taaccacttagattacattacattcatttggttttcgtaaaaccgtttatggtcctgattgcgttagtatatgtctgctggtttcactcttgaacatgga |
4411208 |
T |
|
| Q |
316 |
aaa |
318 |
Q |
| |
|
||| |
|
|
| T |
4411209 |
aaa |
4411211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19401 times since January 2019
Visitors: 3809