View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_low_36 (Length: 331)
Name: NF1576_low_36
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1576_low_36 |
 | |
|
| [»] scaffold0911 (1 HSPs) |
| | |
|
| [»] scaffold0162 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0911 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: scaffold0911
Description:
Target: scaffold0911; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 71 - 315
Target Start/End: Complemental strand, 3352 - 3108
Alignment:
| Q |
71 |
gttgcaactagagtttgaagccacatccagacaagtggaagaggctggggatgtttccattccggtgtctcaagccgaattgcaaacagatttgcaaatg |
170 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||| | |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3352 |
gttgcaaatagagtttgaagacacatccagacaagtggaagaggttcgggatgtttccattccagtgtctcaagccgaattgcaaacagatttgcaaatg |
3253 |
T |
|
| Q |
171 |
cacaaagaatctacgaccatgacctttacttatgaaaatgttagctcagccattcaccatgataagctgccttacacatttgctcatgtacttgaggaaa |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3252 |
cacaaagaatctacgaccatgacctttacttatgaaaatgttagctcagccattcaccatgataagctgccttacacatctgctcatgtacttgaggaaa |
3153 |
T |
|
| Q |
271 |
tcaatgccacagacattgaatcacaacatgataatgcaaggggtg |
315 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3152 |
tcaataccacagacattgaatcacaacatgataatgcaaggggtg |
3108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0162 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0162
Description:
Target: scaffold0162; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 79 - 315
Target Start/End: Complemental strand, 5606 - 5370
Alignment:
| Q |
79 |
tagagtttgaagccacatccagacaagtggaagaggctggggatgtttccattccggtgtctcaagccgaattgcaaacagatttgcaaatgcacaaaga |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5606 |
tagagtttgaagccacatccagacaagtggaagaggttggggatgtttccattccggtgtctcaagtcgaattgcaaacagatttgcaaatgcacaaaga |
5507 |
T |
|
| Q |
179 |
atctacgaccatgacctttacttatgaaaatgttagctcagccattcaccatgataagctgccttacacatttgctcatgtacttgaggaaatcaatgcc |
278 |
Q |
| |
|
| ||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||| || |
|
|
| T |
5506 |
acctacggccatgacctttacttatgaaaatgttaactcagccattcactatgataagctgccttaaacatctgctcatgtacttgaggaaatcaatacc |
5407 |
T |
|
| Q |
279 |
acagacattgaatcacaacatgataatgcaaggggtg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5406 |
acagacattgaatcacaacatgataatgcaaagggtg |
5370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 15 - 71
Target Start/End: Complemental strand, 27539664 - 27539608
Alignment:
| Q |
15 |
gaggaagtagttcctgtcagatcagaggccgtgcccgcagttttaccgactcctatg |
71 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27539664 |
gagggagtagttcctgtcagatcagaggcagtgcccgcagttttaccgactcctatg |
27539608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 14 - 71
Target Start/End: Complemental strand, 15200205 - 15200148
Alignment:
| Q |
14 |
agaggaagtagttcctgtcagatcagaggccgtgcccgcagttttaccgactcctatg |
71 |
Q |
| |
|
||||||||||||||||||||||||||||| || | ||||||||||||||||||||| |
|
|
| T |
15200205 |
agaggaagtagttcctgtcagatcagaggtagtagctgcagttttaccgactcctatg |
15200148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 14 - 71
Target Start/End: Complemental strand, 15219290 - 15219233
Alignment:
| Q |
14 |
agaggaagtagttcctgtcagatcagaggccgtgcccgcagttttaccgactcctatg |
71 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||| ||||||||||| ||||||||| |
|
|
| T |
15219290 |
agaggaagtagttcctgtcagatcataggcagtgcttgcagttttaccaactcctatg |
15219233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 15 - 71
Target Start/End: Complemental strand, 16599518 - 16599462
Alignment:
| Q |
15 |
gaggaagtagttcctgtcagatcagaggccgtgcccgcagttttaccgactcctatg |
71 |
Q |
| |
|
|||| |||| ||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
16599518 |
gagggagtaattcctgtcagatcagaggcaatgccctcagttttaccgactcctatg |
16599462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18126 times since January 2019
Visitors: 3794