View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_low_43 (Length: 282)
Name: NF1576_low_43
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1576_low_43 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 142 - 269
Target Start/End: Original strand, 19596724 - 19596852
Alignment:
Q |
142 |
tgaagaaatgaacatttc-catgatcatatctcctgaaaatgtaactaatatgtaaatttgaacatctttattcactcctcaatcttcttcattcattcc |
240 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
T |
19596724 |
tgaagaaatgaacattttgcatgatcatatctcctgaaaatgtaactaatatgtaaatttgaatatctttattcactccttaatcttcttcattcattcc |
19596823 |
T |
|
Q |
241 |
tcaatcttctttgaattgtctgatgatgt |
269 |
Q |
|
|
|||||||||||||||||||||||| |||| |
|
|
T |
19596824 |
tcaatcttctttgaattgtctgataatgt |
19596852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 19596623 - 19596667
Alignment:
Q |
1 |
attactgatcaaccatttatttattcatgaacaaatacagtacaa |
45 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
19596623 |
attactgatcaaccatttatttattcatgaacaaatacaatacaa |
19596667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18207 times since January 2019
Visitors: 3796