View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1576_low_44 (Length: 282)

Name: NF1576_low_44
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1576_low_44
NF1576_low_44
[»] chr8 (2 HSPs)
chr8 (125-271)||(34041134-34041280)
chr8 (6-117)||(34042005-34042116)


Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 125 - 271
Target Start/End: Complemental strand, 34041280 - 34041134
Alignment:
125 tgcagaataacgatgtctctttaaaagtattattatggggtgaattctacttcattttttagtggattaacttgatgaatctataattggatggagggtt 224  Q
    |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||    
34041280 tgcagaataacgatgtctgtttaaa-gtattattatggggtgaattctacttcattttttagtggatgaacttgatgaatttataattggatggagggtt 34041182  T
225 gg-taattggatcaaattgttatctctatttcaatcaatagggtctgt 271  Q
    || |||||||||||||||||||||||||||||||||||||||||||||    
34041181 ggttaattggatcaaattgttatctctatttcaatcaatagggtctgt 34041134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 6 - 117
Target Start/End: Complemental strand, 34042116 - 34042005
Alignment:
6 acatcatggattgcaatatactaataataggtcacagtcacagcttttgccatttaaaatcagtcaacagacataatagacctcaaaaatcttgactatc 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34042116 acatcatggattgcaatatactaataataggtcacagtcacagcttttgccatttaaaatcagtcaacagacataatagacctcaaaaatcttgactatc 34042017  T
106 aattgtagtttt 117  Q
    ||||||||||||    
34042016 aattgtagtttt 34042005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 16602 times since January 2019
Visitors: 3770