View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_low_48 (Length: 263)
Name: NF1576_low_48
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1576_low_48 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 11 - 153
Target Start/End: Complemental strand, 48960855 - 48960713
Alignment:
Q |
11 |
agatgaagaagaattaggaaacaagcccctatgaggtggagatgaaaatgtttgttctgttttcttttcttgaggttgagtctgattatgaggtgatggg |
110 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
48960855 |
agatgaagaagaattgggaaacaagcccctatgaggtggagatgaaagtgtttgttctgttttcttttcttgaggttgagtttgattatgaggtgatggg |
48960756 |
T |
|
Q |
111 |
ggtgctgaagcagtcctaaatgtgggtagagacatagtagggc |
153 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48960755 |
ggtgctgaagcagtcctaaatgtgggtagagacatagtagggc |
48960713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 280 times since January 2019
Visitors: 3989