View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_low_51 (Length: 253)
Name: NF1576_low_51
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1576_low_51 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 37510686 - 37510478
Alignment:
Q |
14 |
cagagagagtttatgggctaactcaatgcacaagagacatttctagtgttgattgtaagaagtgtcttgatggtgcaattagtgaacttccaaattgttg |
113 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37510686 |
cagagagagtttatgggctaactcaatgcactagagacatttctagtgttgattgtaagaagtgtcttgatggtgcaattagtgaacttccaaattgttg |
37510587 |
T |
|
Q |
114 |
tgatggnnnnnnnggaggcagagttgttggtggaagttgcaatattcgatatgaaatttaccctttcgttagggagtaaactccaactttgtatatatta |
213 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
37510586 |
tgatggaaaaaaaggaggcagagttgttggtggaagttgcaatattcgatatgaaatttaccctttcgttagggagtaaactccaactttggatatatta |
37510487 |
T |
|
Q |
214 |
agttatcat |
222 |
Q |
|
|
||||||||| |
|
|
T |
37510486 |
agttatcat |
37510478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 23 - 176
Target Start/End: Original strand, 37531179 - 37531332
Alignment:
Q |
23 |
tttatgggctaactcaatgcacaagagacatttctagtgttgattgtaagaagtgtcttgatggtgcaattagtgaacttccaaattgttgtgatggnnn |
122 |
Q |
|
|
|||||||| ||||||| ||||| |||||| ||||||||| |||||| ||||| |||||||||| |||||||| |||||||| ||||||||||||||| |
|
|
T |
37531179 |
tttatgggttaactcagtgcactagagacctttctagtgctgattgcaagaattgtcttgatgctgcaattaatgaacttcgaaattgttgtgatggaaa |
37531278 |
T |
|
Q |
123 |
nnnnggaggcagagttgttggtggaagttgcaatattcgatatgaaatttaccc |
176 |
Q |
|
|
||||| ||||||||||| ||||| ||||| |||||||||| || ||||| |
|
|
T |
37531279 |
agaaggaggtagagttgttgggggaagctgcaactttcgatatgagatataccc |
37531332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 54 - 152
Target Start/End: Original strand, 37534578 - 37534676
Alignment:
Q |
54 |
ttctagtgttgattgtaagaagtgtcttgatggtgcaattagtgaacttccaaattgttgtgatggnnnnnnnggaggcagagttgttggtggaagttg |
152 |
Q |
|
|
||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
T |
37534578 |
ttctagtattgattgtaagaagtgtcttgatgatgcaattaatgaacttccaaattgttgtgatggaaaagaaggaggtagagttgttggtggaagttg |
37534676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16569 times since January 2019
Visitors: 3769