View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_low_66 (Length: 210)
Name: NF1576_low_66
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1576_low_66 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 40497837 - 40497628
Alignment:
| Q |
1 |
ctttctaaccttgaccaaaatatagcatatccagttcgtacaatttactgttataaatcactttcaaaaggcaatgaggatgttgcacaagttcttaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40497837 |
ctttctaaccttgaccaaaatatagcatatccagttcgtacaatttactgttataaatcactttcaaaaggcaatgaggatgttgcacaagttcttaagg |
40497738 |
T |
|
| Q |
101 |
attcattgtcaaagattcttgttcactactatcccatggctggaaggttgaaaataagctcagaaggaaagttgacaatagactgcaatgaagagggtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40497737 |
attcattgtcaaagattcttgttcactactatcccatggctggaaggttgaaaataagctcagaaggaaagttgacaatagactgcaatgaagagggtgt |
40497638 |
T |
|
| Q |
201 |
tgtatttgtt |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
40497637 |
tgtatttgtt |
40497628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19235 times since January 2019
Visitors: 3808