View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_low_67 (Length: 207)
Name: NF1576_low_67
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1576_low_67 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 13073187 - 13073360
Alignment:
Q |
18 |
ccaaatacggtattcaacacttcttcgatcgccacacaactcaacaacaaaactctcagaaacttcaatccaccgattcaaatgcaacatctcaagttgc |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
T |
13073187 |
ccaaatacggtattcaacacttcttcgatcgccacacaactcaacaacaaaactctcagaaacttcaatccaacaattcaaatgcaacatctcaagttgc |
13073286 |
T |
|
Q |
118 |
tgatgctgcttccgattctcgaccaccgccggaaaaatccaccgatgctgttaatgaggctgatacgttatctg |
191 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
13073287 |
tgatgctgcttccgattctcgaccaccgccggaaaaatctaccgatgctgttaatgaggctgatacgttatctg |
13073360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16577 times since January 2019
Visitors: 3770