View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_low_68 (Length: 204)
Name: NF1576_low_68
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1576_low_68 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 47706977 - 47706895
Alignment:
Q |
23 |
gtatcatgtatagctgttaataaaagtttaaaaaatggaaagagaggttttctctttttgttgaagaagcaagaacttgcagg |
105 |
Q |
|
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47706977 |
gtatcatgtatagctgttaataaaactttcaaaaatggaaagagaggttttctctttttgttgaagaagcaagaacttgcagg |
47706895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19402 times since January 2019
Visitors: 3809