View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1613_high_1 (Length: 479)
Name: NF1613_high_1
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1613_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 446; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 446; E-Value: 0
Query Start/End: Original strand, 12 - 465
Target Start/End: Complemental strand, 52913440 - 52912987
Alignment:
| Q |
12 |
attcttttaaagctcaccgttaatctaaacatgtacttaccatcttctggctgagaggctggcgttgaattcttgccaatcacaatttggacatggattg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52913440 |
attcttttaaagctcaccgttaatctaaacatgcacttaccatcttctggctgagaggctggcgttgaattcttgccaatcacaatttggacatggattg |
52913341 |
T |
|
| Q |
112 |
aaggttctaacgctacggtctccatcgttgaaaccaccggtttggataagagttccgttgggattgacggaaccggaggaacaccagatgttggtttgga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52913340 |
aaggttctaacgctacggtctccatcgttgaaaccaccggtttggataagagttccgttgggattgacggaaccggaggaacaccagatgttggtttgga |
52913241 |
T |
|
| Q |
212 |
tgaagagtggtcggaatgtattagaaaagacgtcatattcaagggagtgagcagtgcaatcatttttaacagcttgctcttgtgggttaacacggcatct |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52913240 |
tgaagagtggtcggaatgtattagaaaagacgtcatattcaagggagtgagcagtgcaatcatttttcacagcttgctcttgtgggttaacacggcatct |
52913141 |
T |
|
| Q |
312 |
accgttgggtaaagataagtttgagaagccaaaatctgtacggtcaaaaatgatgacacggtcgttgtgtagtaattgcatatgcatggctacaatgcca |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52913140 |
accgttgggtaaagataagtttgagaagccaaaatctgtacggtcaaaaatgatgacacggtcgttgtgtagtaattgcatatgcatggctacaatgcca |
52913041 |
T |
|
| Q |
412 |
atgttgttttgtaagagctgccattgtccaccagcggctatagctggagatgga |
465 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52913040 |
atgttgttttgtaagagctgccattgtccaccagcggctatagctggagatgga |
52912987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 133 - 197
Target Start/End: Complemental strand, 16846220 - 16846156
Alignment:
| Q |
133 |
ccatcgttgaaaccaccggtttggataagagttccgttgggattgacggaaccggaggaacacca |
197 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||| |||| ||| | ||||||||||||||| |
|
|
| T |
16846220 |
ccatcgttgaagccaccggtttggattagggttccggtgggggagactgcaccggaggaacacca |
16846156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11046 times since January 2019
Visitors: 8059